Metribolone
Member
Looks like we’re kinda fucked. I’m just gonna hope that it will get better on its own.
MESO-Rx
Anabolic Steroids
Anyone worried about prion diseases from impure peptides?
- Thread starter Metribolone
- Start date
You should start reading about this topic. There's are a lot of very smart people who are working on trying to figure out solutions. A lot of excellent content. A lot of great research. It depends how much you are willing to try and read. I can give you some links to some substacks that are very good.
Most importantly, "they" will do this again, meaning there will be another "pandemic" with accompanying forced injections. You will need to understand what happened this time, so you can understand what will happen the next time. You will need to understand this topic so you will know 100% that you won't fall for this again.
Keep your blood thin, take your vitamins, research, and try and live as healthily as you can. Humans are survivors and you give yourself the best chance if you are aware of the problems.
I wouldn't worry about the peptides because they have the potential to do more good than harm for you, at this point.
In no particular order and I'm missing some but here are some pages to read:
Unacceptable Jessica | Jessica Rose | Substack
Jessica's Substack about all things SCIENCE and IMMUNOLOGY. Click to read Unacceptable Jessica, by Jessica Rose, a Substack publication with tens of thousands of subscribers.
jessicar.substack.com
Steve Kirsch's newsletter | Substack
I write about COVID mitigation policies, vaccines, corruption, censorship, and early treatments. The data shows that vaccines are ruining the health of Americans and driving the epidemic in a variety of health conditions. Click to read Steve Kirsch's newsletter, a Substack publication with...
stevekirsch.substack.com
Arkmedic's blog | Dr Ah Kahn Syed | Substack
Striving for truth and transparency in science and medicine. Posts should be considered public interest disclosures in relevant jurisdictions. All comment sections are open so if you see a scientific or factual error please comment. Click to read Arkmedic's blog, by Dr Ah Kahn Syed, a Substack...
arkmedic.substack.com
Things Hidden in Complexity | Moriarty | Substack
Multidisciplinary analysis of current trends, unexplored connections. Click to read Things Hidden in Complexity, by Moriarty, a Substack publication with thousands of subscribers.
hiddencomplexity.substack.com
UK: Births in England Collapsed and are NOT Coming Back Up
Births Declined by 14%. Should we call it INFERTILITY?
igorchudov.substack.com
WMC Research | Walter M Chesnut | Substack
COVID-19 Research. Click to read WMC Research, by Walter M Chesnut, a Substack publication with tens of thousands of subscribers.
wmcresearch.substack.com
James Hill MD’s Newsletter | James Hill, MD | Substack
Musings on medicine and current events. Click to read James Hill MD’s Newsletter, by James Hill, MD, a Substack publication with thousands of subscribers.
hillmd.substack.com
genuineprospect | Dr Lidiya Angelova | Substack
Get informed about COVID-19 and world affairs by unbiased scientific point of view. Check my new Natural Remedy Series. Click to read genuineprospect, by Dr Lidiya Angelova, a Substack publication with thousands of subscribers.
angelovalidiya.substack.com
GenuineProspect
eugyppius: a plague chronicle | Substack
We are witnessing an unprecedented, comprehensive failure of policy, medicine and science. The world will never be the same. Click to read eugyppius: a plague chronicle, a Substack publication with tens of thousands of subscribers.
eugyppius.substack.com
Prometheus Shrugged | Charles Rixey, MA, MBA (c) | Substack
DRASTIC's COVID-19 Origin Investigations - General Political & Data Analysis. Click to read Prometheus Shrugged, by Charles Rixey, MA, MBA (c), a Substack publication with thousands of subscribers.
prometheusshrugged.substack.com
Unacceptable Jessica | Jessica Rose | Substack
Jessica's Substack about all things SCIENCE and IMMUNOLOGY. Click to read Unacceptable Jessica, by Jessica Rose, a Substack publication with tens of thousands of subscribers.
jessicar.substack.com
England Deaths by Vaccination Status
Whichever way you cut it, it's not good for the vaccinated (unless you're the ONS of course).
metatron.substack.com
PSA - Why You Shouldn’t Take the Vaccine
A highly condensed primer on why these vaccines are so dangerous
iceni.substack.com
Metribolone
Member
I’ll take a lookYou should start reading about this topic. There's are a lot of very smart people who are working on trying to figure out solutions. A lot of excellent content. A lot of great research. It depends how much you are willing to try and read. I can give you some links to some substacks that are very good.
Most importantly, "they" will do this again, meaning there will be another "pandemic" with accompanying forced injections. You will need to understand what happened this time, so you can understand what will happen the next time. You will need to understand this topic so you will know 100% that you won't fall for this again.
Keep your blood thin, take your vitamins, research, and try and live as healthily as you can. Humans are survivors and you give yourself the best chance if you are aware of the problems.
I wouldn't worry about the peptides because they have the potential to do more good than harm for you, at this point.
In no particular order and I'm missing some but here are some pages to read:
Unacceptable Jessica | Jessica Rose | Substack
Jessica's Substack about all things SCIENCE and IMMUNOLOGY. Click to read Unacceptable Jessica, by Jessica Rose, a Substack publication with tens of thousands of subscribers.
Steve Kirsch's newsletter | Substack
I write about COVID mitigation policies, vaccines, corruption, censorship, and early treatments. The data shows that vaccines are ruining the health of Americans and driving the epidemic in a variety of health conditions. Click to read Steve Kirsch's newsletter, a Substack publication with...
Arkmedic's blog | Dr Ah Kahn Syed | Substack
Striving for truth and transparency in science and medicine. Posts should be considered public interest disclosures in relevant jurisdictions. All comment sections are open so if you see a scientific or factual error please comment. Click to read Arkmedic's blog, by Dr Ah Kahn Syed, a Substack...
Things Hidden in Complexity | Moriarty | Substack
Multidisciplinary analysis of current trends, unexplored connections. Click to read Things Hidden in Complexity, by Moriarty, a Substack publication with thousands of subscribers.
UK: Births in England Collapsed and are NOT Coming Back Up
Births Declined by 14%. Should we call it INFERTILITY?
WMC Research | Walter M Chesnut | Substack
COVID-19 Research. Click to read WMC Research, by Walter M Chesnut, a Substack publication with tens of thousands of subscribers.
James Hill MD’s Newsletter | James Hill, MD | Substack
Musings on medicine and current events. Click to read James Hill MD’s Newsletter, by James Hill, MD, a Substack publication with thousands of subscribers.
genuineprospect | Dr Lidiya Angelova | Substack
Get informed about COVID-19 and world affairs by unbiased scientific point of view. Check my new Natural Remedy Series. Click to read genuineprospect, by Dr Lidiya Angelova, a Substack publication with thousands of subscribers.
GenuineProspect
eugyppius: a plague chronicle | Substack
We are witnessing an unprecedented, comprehensive failure of policy, medicine and science. The world will never be the same. Click to read eugyppius: a plague chronicle, a Substack publication with tens of thousands of subscribers.
Prometheus Shrugged | Charles Rixey, MA, MBA (c) | Substack
DRASTIC's COVID-19 Origin Investigations - General Political & Data Analysis. Click to read Prometheus Shrugged, by Charles Rixey, MA, MBA (c), a Substack publication with thousands of subscribers.
Unacceptable Jessica | Jessica Rose | Substack
Jessica's Substack about all things SCIENCE and IMMUNOLOGY. Click to read Unacceptable Jessica, by Jessica Rose, a Substack publication with tens of thousands of subscribers.
England Deaths by Vaccination Status
Whichever way you cut it, it's not good for the vaccinated (unless you're the ONS of course).
PSA - Why You Shouldn’t Take the Vaccine
A highly condensed primer on why these vaccines are so dangerous
This link has a collection of studies and research that is worth saving. last update APR-17, 2023 notes on... - TextUp
From that link, here are some prion resources:
PRION DISEASES - PROTECTION and possible TREATMENTS - yogurt, curry and capers]
[2021]
*More context; protective effects of RESVERATROL, LACTOFERRIN, MELATONIN:
Autophagy induced by resveratrol prevents human prion protein-mediated neurotoxicity - PubMed
Autophagy induced by resveratrol prevents human prion protein-mediated neurotoxicit
Jeong et al
Resveratrol initiates neuroprotective effects via the activation of autophagy, which protects organelles, cells, and organisms against misfolded protein-disorders
Melatonin-induced autophagy protects against human prion protein-mediated neurotoxicity - PubMed
Melatonin-induced autophagy protects against human prion protein-mediated neurotoxicity
Jeong et al
protective effect of melatonin against mitochondrial dysfunction was related with autophagy activation.
Lactoferrin protects against prion protein-induced cell death in neuronal cells by preventing mitochondrial dysfunction
Lactoferrin protects against prion protein-induced cell death in neuronal cells by preventing mitochondrial dysfunction
Park et al
These results demonstrated that LF protects neuronal cells against PrP (106-126)-mediated neurotoxicity through the scavenging of ROS and provide evidence that LF treatment prevents neuronal cell death caused by PrP
Lactoferrin decreases LPS-induced mitochondrial dysfunction in cultured cells and in animal endotoxemia model
Lactoferrin decreases LPS-induced mitochondrial dysfunction in cultured cells and in animal endotoxemia model
Kurzel et al
lactoferrin protects against oxidative insult at the mitochondrial level
2022]
*More context; protective effects of QUERCETIN AND CURCUMIN:
Quercetin turns fibrils into protease-sensitive, structurally loose and non-cytotoxic forms
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Chi-Fen Lin et al
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress - PubMed
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress
Kun-Hua Yu, Cheng-I Lee
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Kun-HuaYua et al
[AMYLOIDOSIS - PROTECTION and possible TREATMENTS - yogurt, curry, capers]
[2022]
Quercetin turns fibrils into protease-sensitive, structurally loose and non-cytotoxic forms
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Chi-Fen Lin et al
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress - PubMed
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress
Kun-Hua Yu, Cheng-I Lee
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Kun-HuaYua et al
Natural product-based amyloid inhibitors - PubMed
Natural product-based amyloid inhibitors
Paul Velander 1, Ling Wu 1, Frances Henderson 1, Shijun Zhang 2, David R Bevan 3, Bin Xu 4
[2023]
Quercetin as a possible complementary agent for early-stage COVID-19: Concluding results of a randomized clinical trial
Quercetin as a possible complementary agent for early-stage COVID-19: Concluding results of a randomized clinical trial
Di Pierro et al
Our results, suggest the possible therapeutic role of quercetin in early-stage COVID-19, including speedy clearance of SARS-CoV-2, early resolution of the acute symptoms and modulation of the host’s hyperinflammatory response.
==============================================================
[AMYLOIDOSIS - ALZHEIMER - infection, spike, treatments]
[CONTEXT]
https://www.researchgate.net/public...ion_of_Amyloid_Formation_in_Aging_and_Disease
https://www.researchgate.net/figure...lded-protein-can-be-refolded-1_fig2_313698560
Neurophage.com
RESVERATROL, LACTOFERRIN, MELATONIN, QUERCETIN and CURCUMIN proved to have PROTECTIVE EFFECTS.
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress - PubMed
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Lactoferrin decreases LPS-induced mitochondrial dysfunction in cultured cells and in animal endotoxemia model
Melatonin-induced autophagy protects against human prion protein-mediated neurotoxicity - PubMed
Autophagy induced by resveratrol prevents human prion protein-mediated neurotoxicity - PubMed
https://pubmed.ncbi.nlm.nih.gov/28390938
==============================================================
[PRION DISEASES - ALZHEIMER - infection, spike protein, possible treatments]
[CONTEXT]
*SARS-CoV-2 spike protein is a transmembrane protein, and it contains five GxxxG motifs in its sequence (see uniprot.org/uniprot/P0DTC2), it's extremely plausible that it could behave as a prion.
*Did you know that, back in the Paleolithic, a super-prion pandemic almost wiped out humanity as a whole? Then humans developed a gene that protected against the infection and nowadays confers an slight resistance to other prion diseases. The only people in the world that don't have that gene are the Japanese.
https://pubmed.ncbi.nlm.nih.gov/24398570/
*RESVERATROL, LACTOFERRIN, MELATONIN, QUERCETIN and CURCUMIN proved to have PROTECTIVE EFFECTS.
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress - PubMed
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Lactoferrin decreases LPS-induced mitochondrial dysfunction in cultured cells and in animal endotoxemia model
Melatonin-induced autophagy protects against human prion protein-mediated neurotoxicity - PubMed
Autophagy induced by resveratrol prevents human prion protein-mediated neurotoxicity - PubMed
From that link, here are some prion resources:
PRION DISEASES - PROTECTION and possible TREATMENTS - yogurt, curry and capers]
[2021]
*More context; protective effects of RESVERATROL, LACTOFERRIN, MELATONIN:
Autophagy induced by resveratrol prevents human prion protein-mediated neurotoxicity - PubMed
Autophagy induced by resveratrol prevents human prion protein-mediated neurotoxicit
Jeong et al
Resveratrol initiates neuroprotective effects via the activation of autophagy, which protects organelles, cells, and organisms against misfolded protein-disorders
Melatonin-induced autophagy protects against human prion protein-mediated neurotoxicity - PubMed
Melatonin-induced autophagy protects against human prion protein-mediated neurotoxicity
Jeong et al
protective effect of melatonin against mitochondrial dysfunction was related with autophagy activation.
Lactoferrin protects against prion protein-induced cell death in neuronal cells by preventing mitochondrial dysfunction
Lactoferrin protects against prion protein-induced cell death in neuronal cells by preventing mitochondrial dysfunction
Park et al
These results demonstrated that LF protects neuronal cells against PrP (106-126)-mediated neurotoxicity through the scavenging of ROS and provide evidence that LF treatment prevents neuronal cell death caused by PrP
Lactoferrin decreases LPS-induced mitochondrial dysfunction in cultured cells and in animal endotoxemia model
Lactoferrin decreases LPS-induced mitochondrial dysfunction in cultured cells and in animal endotoxemia model
Kurzel et al
lactoferrin protects against oxidative insult at the mitochondrial level
2022]
*More context; protective effects of QUERCETIN AND CURCUMIN:
Quercetin turns fibrils into protease-sensitive, structurally loose and non-cytotoxic forms
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Chi-Fen Lin et al
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress - PubMed
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress
Kun-Hua Yu, Cheng-I Lee
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Kun-HuaYua et al
[AMYLOIDOSIS - PROTECTION and possible TREATMENTS - yogurt, curry, capers]
[2022]
Quercetin turns fibrils into protease-sensitive, structurally loose and non-cytotoxic forms
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Chi-Fen Lin et al
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress - PubMed
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress
Kun-Hua Yu, Cheng-I Lee
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Kun-HuaYua et al
Natural product-based amyloid inhibitors - PubMed
Natural product-based amyloid inhibitors
Paul Velander 1, Ling Wu 1, Frances Henderson 1, Shijun Zhang 2, David R Bevan 3, Bin Xu 4
[2023]
Quercetin as a possible complementary agent for early-stage COVID-19: Concluding results of a randomized clinical trial
Quercetin as a possible complementary agent for early-stage COVID-19: Concluding results of a randomized clinical trial
Di Pierro et al
Our results, suggest the possible therapeutic role of quercetin in early-stage COVID-19, including speedy clearance of SARS-CoV-2, early resolution of the acute symptoms and modulation of the host’s hyperinflammatory response.
==============================================================
[AMYLOIDOSIS - ALZHEIMER - infection, spike, treatments]
[CONTEXT]
https://www.researchgate.net/public...ion_of_Amyloid_Formation_in_Aging_and_Disease
https://www.researchgate.net/figure...lded-protein-can-be-refolded-1_fig2_313698560
Neurophage.com
RESVERATROL, LACTOFERRIN, MELATONIN, QUERCETIN and CURCUMIN proved to have PROTECTIVE EFFECTS.
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress - PubMed
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Lactoferrin decreases LPS-induced mitochondrial dysfunction in cultured cells and in animal endotoxemia model
Melatonin-induced autophagy protects against human prion protein-mediated neurotoxicity - PubMed
Autophagy induced by resveratrol prevents human prion protein-mediated neurotoxicity - PubMed
https://pubmed.ncbi.nlm.nih.gov/28390938
==============================================================
[PRION DISEASES - ALZHEIMER - infection, spike protein, possible treatments]
[CONTEXT]
*SARS-CoV-2 spike protein is a transmembrane protein, and it contains five GxxxG motifs in its sequence (see uniprot.org/uniprot/P0DTC2), it's extremely plausible that it could behave as a prion.
*Did you know that, back in the Paleolithic, a super-prion pandemic almost wiped out humanity as a whole? Then humans developed a gene that protected against the infection and nowadays confers an slight resistance to other prion diseases. The only people in the world that don't have that gene are the Japanese.
https://pubmed.ncbi.nlm.nih.gov/24398570/
*RESVERATROL, LACTOFERRIN, MELATONIN, QUERCETIN and CURCUMIN proved to have PROTECTIVE EFFECTS.
Quercetin binding accelerates prion fibrillation into proteinase sensitive and loosely structured amyloids
Quercetin Disaggregates Prion Fibrils and Decreases Fibril-Induced Cytotoxicity and Oxidative Stress - PubMed
Curcumin Reduces Amyloid Fibrillation of Prion Protein and Decreases Reactive Oxidative Stress
Lactoferrin decreases LPS-induced mitochondrial dysfunction in cultured cells and in animal endotoxemia model
Melatonin-induced autophagy protects against human prion protein-mediated neurotoxicity - PubMed
Autophagy induced by resveratrol prevents human prion protein-mediated neurotoxicity - PubMed
Night_Owl
Well-known Member
@Inspired thank you for once again providing this forum with an abundance of great information!
Quick question in regards to something that was mentioned earlier in the thread: would an impure peptide have the ability to replicate itself and cause prion disease?
I know the chance is small but is that how it would work, theoretically speaking? Just trying to understand how it would work. Thanks again.
Quick question in regards to something that was mentioned earlier in the thread: would an impure peptide have the ability to replicate itself and cause prion disease?
I know the chance is small but is that how it would work, theoretically speaking? Just trying to understand how it would work. Thanks again.
Night_Owl
Well-known Member
I know cerebrolysin has people worried because it comes from pig brain. Although, I've heard pigs are very resistant to prion disease.
I have quite the case of tenniselbow. After starting serrapeptase I started getting these weird pains in the elbow which persisted for a month. One could speculate it ate away at the dead scar tissue. It's nothing magical tho, did not "fix" my tennis elbow.
I never said they were, but some of these guys have no idea what they’re talking about and continue to spread gross misinformation.
I’m saying that if a misfolded protein gets into the peptide product, you are screwed. His response centers around probability of getting it without realizing that prions ARE infectious.
Prions misfold all the time. Usually your body destroys them.
Also, prions contain peptide chains and work very closely with peptides that bind to prion proteins, particularly prion peptide 106-126 and laminin γ1. Guess what? Peptides can significantly increase the risk of contracting a prion disease if they interact with those proteins.
This has nothing to do with the base probability of contracting it.
Ways to get prions:
1) Genetic problems (FFL, etc).
2) A fluke of nature, random occurrence.
3) Consuming prion-infected ANYTHING.
4) Injecting prion-infected peptides.
5) Injecting prion-interacting peptides.
So, as someone who works very closely with genetic science… no.
These proteins you mentioned aren’t what you think they are.
First, you can obtain information about these proteins in your body by getting your blood tested for COVID antibodies. You don’t need a biopsy at all.
Second, these antibodies are also produced by your body while fighting covid. The vaccines just speed it up. They actually prevent you from developing amyloidosis.
Thirdly, I shit you not, severe COVID itself causes amyloidosis in some people, and therefore “long COVID” and “brain fog” symptoms, and a blood test can show if you have Serum amyloid A markers. If you have them, it’s indicative of overactive inflammatory immune responses and cytokine storms. Amyloidosis induces inflammation, clot formation and injury to the tissue and organ. This can cause kidney failure and blood clots, and damage organs.
May the Fourthly (ha), mRNA doesn’t work like that. mRNA is basically a 3D printer for any kind of genetic sequence. This sequence can do anything eventually, including clone people, or right now in its infancy, clone the COVID spike glycoprotein or something else equally small. This glycoprotein is how COVID attaches itself to the ACE2 receptors in the human body. These cells are over expressed in your lungs, and other organs… and guess what? Your testicles. In rare causes, COVID can cause infertility.
Fifthly, yes, the mRNA vaccine CAN cause myocarditis in some patients, but this is very, very rare. These patients have elevated levels of full-length spike protein which are unbound by antibodies.
And finally, your body doesn’t produce more spike glycoproteins unless COVID is successfully infecting your cells and reproducing.!At all. Full stop. If it isn’t cleared by your immune system after several months, and your levels are just as high, then your immune system simply isn’t working. The spike glycoproteins that get into your body are supposed to be attacked and destroyed by your immune system. In some people, this doesn’t happen… and combined with more COVID in the body, good luck.
Last edited:
To add to the above post… the reason why the original COVID vaccine isn’t effective against later variants is due to the virus adapting. But it isn’t adapting in the way most people think.
Later versions of COVID severely out-compete older strains, leading to the deaths of the original strains, or the suppression of it. Eventually most of our immune systems can adapt and overcome it.
So how are these viruses adapting? They’re actually losing information, OR changing their alleles via mutation. It all comes down to genetics. A quick crash course in genes: DNA is a double helix, with a double strand, each one having a large collection of single nucleotide polymorphisms, each with two alleles. These alleles are based on ACGT: adenine (A), cytosine (C), guanine (G), and thymine (T), the chemical makeup of DNA, and what gives you your traits and makes you you, etc. So imagine you have a rare genetic disorder caused by a T/A mutation, and this is the affected genotype… if you marry a woman who has G/G and have a baby, your child will be unaffected. Now let’s apply this somewhere else.
Now, this is just an example, but imagine your typical COVID virus’ genetic code looks like this:
GATAAAAGAGAGTATACAGGAGAGGTATTGC
What happens if the virus starts losing information along the way? What if it becomes:
GATAAAAGAGAGT<stop codon>GAGAGGTATTGC
And suddenly the virus is able to avoid genetic checks that let it decide whether or not to affect a cell. This could end up producing a more virulent strain far worse than the one in the beginning. Or what if it mutates and the alleles change? Same thing.
But over time, more and more genetic information is lost. This may end up making the virus harmless in the long run and it’ll just reproduce and survive as a less dangerous strain, but possibly affecting everyone far quicker.
This is why the later strains are really weak. COVID mutated so fast, and lost so much genetic information, that it eventually became weak. But two strains really fucked shit up at the beginning, despite internet conspiracy theorists stating otherwise.
Not all viruses (or bacteria!) mutate this quickly. Some things can be far worse. We are talking Black Death levels of suffering. COVID wasn’t as bad as everyone thought, but it was really bad, especially for those who were immunocompromised.
I strongly suggest politically supporting pandemic planning, policies and procedures — regardless of your political leanings. Next time we might not be so lucky.
Later versions of COVID severely out-compete older strains, leading to the deaths of the original strains, or the suppression of it. Eventually most of our immune systems can adapt and overcome it.
So how are these viruses adapting? They’re actually losing information, OR changing their alleles via mutation. It all comes down to genetics. A quick crash course in genes: DNA is a double helix, with a double strand, each one having a large collection of single nucleotide polymorphisms, each with two alleles. These alleles are based on ACGT: adenine (A), cytosine (C), guanine (G), and thymine (T), the chemical makeup of DNA, and what gives you your traits and makes you you, etc. So imagine you have a rare genetic disorder caused by a T/A mutation, and this is the affected genotype… if you marry a woman who has G/G and have a baby, your child will be unaffected. Now let’s apply this somewhere else.
Now, this is just an example, but imagine your typical COVID virus’ genetic code looks like this:
GATAAAAGAGAGTATACAGGAGAGGTATTGC
What happens if the virus starts losing information along the way? What if it becomes:
GATAAAAGAGAGT<stop codon>GAGAGGTATTGC
And suddenly the virus is able to avoid genetic checks that let it decide whether or not to affect a cell. This could end up producing a more virulent strain far worse than the one in the beginning. Or what if it mutates and the alleles change? Same thing.
But over time, more and more genetic information is lost. This may end up making the virus harmless in the long run and it’ll just reproduce and survive as a less dangerous strain, but possibly affecting everyone far quicker.
This is why the later strains are really weak. COVID mutated so fast, and lost so much genetic information, that it eventually became weak. But two strains really fucked shit up at the beginning, despite internet conspiracy theorists stating otherwise.
Not all viruses (or bacteria!) mutate this quickly. Some things can be far worse. We are talking Black Death levels of suffering. COVID wasn’t as bad as everyone thought, but it was really bad, especially for those who were immunocompromised.
I strongly suggest politically supporting pandemic planning, policies and procedures — regardless of your political leanings. Next time we might not be so lucky.
Last edited:
You have absolutely ZERO idea about what you're talking about. Go read those links I posted and get educated. Unbelievable that we are this point of knowledge and people like you are still this uneducated.
JuiceJohn
Member
Prion diseases result from the misfolding of normal proteins in the brain, not from impure peptides. Impure peptides may contain contaminants or impurities that can cause other health issues, but they are not directly linked to prion diseases. Prion diseases are characterized by abnormal protein conformations, not impurities as far as I have read. Prion diseases are pretty rare.
janoshik
Subscriber
Short peptides, such as those under 50 amino acids, are made with a process than has no chance of introducing prions or anything like that.
You have no idea what you’re talking about, and it’s very clear.
Except that I know what I am talking about........but I don't have time or energy to educate you. Go read and digest those substacks, dig through the articles, read the literature, and then get back to me. If you're not willing to do that, or if you do it and still don't understand, then you're just another NPC trapped in the matrix, and no one can help you. Goodluck.
And how do we know those peptides truly are short and don’t turn into polypeptides during the process? Have you done any testing on these peptides to find out? Sounds like an additional service you can offer.
Respectfully, you sound like the only one here concerned and the proliferation of injectable peptides available from hundreds of sources being used by millions of people across the world not giving rise to increase of this disease would seem to speak to it not being of large concern...
janoshik
Subscriber
Things generally don't happen against the laws of thermodynamics and I don't wish to exploit my clients by pretending to protect them from something that I don't find likely at all.
I’m not really concerned about it. In fact, I take peptides all the time. I’m just saying, “what if.”
Also, prions take up to 30 years to affect you.
Similar threads
Sponsors
Latest posts
-
-
Sigma Audley Inc. - Your source for peptides, ancillaries, AAS, and more!- Latest: Trenbolonetax
